Journal of Reproductive Immunology
Volume 84, Issue 1 , Pages 41-51, January 2010

Expression and function of Toll-like receptors in human endometrial epithelial cell lines

  • Wedad Aboussahoud

      Affiliations

    • Academic Unit of Reproductive and Developmental Medicine, The University of Sheffield, Level 4, Jessop Wing, Tree Root Walk, Sheffield S10 2SF, UK
    • ,
  • Reza Aflatoonian

      Affiliations

    • Academic Unit of Reproductive and Developmental Medicine, The University of Sheffield, Level 4, Jessop Wing, Tree Root Walk, Sheffield S10 2SF, UK
    • Present address: Reproductive and Biomedicine Group, Medical School, Iran University of Medical Sciences, Tehran 14155-5983, Iran.
    • ,
  • Chris Bruce

      Affiliations

    • Academic Unit of Reproductive and Developmental Medicine, The University of Sheffield, Level 4, Jessop Wing, Tree Root Walk, Sheffield S10 2SF, UK
    • ,
  • Sarah Elliott

      Affiliations

    • Academic Unit of Reproductive and Developmental Medicine, The University of Sheffield, Level 4, Jessop Wing, Tree Root Walk, Sheffield S10 2SF, UK
    • ,
  • Jon Ward

      Affiliations

    • Cardiovascular Research Unit, Royal Hallamshire Hospital, Glossop Road, University of Sheffield, Sheffield S10 2JF, UK
    • ,
  • Sue Newton

      Affiliations

    • Medical School, University of Sheffield Beech Hill Road, Sheffield S10 2RX, UK
    • ,
  • Sabine Hombach-Klonisch

      Affiliations

    • Department Human Anatomy and Cell Science, Faculty of Medicine, University of Manitoba, Winnipeg R3E 0J9, Canada
    • ,
  • Thomas Klonisch

      Affiliations

    • Department Human Anatomy and Cell Science, Faculty of Medicine, University of Manitoba, Winnipeg R3E 0J9, Canada
    • ,
  • Alireza Fazeli

      Affiliations

    • Academic Unit of Reproductive and Developmental Medicine, The University of Sheffield, Level 4, Jessop Wing, Tree Root Walk, Sheffield S10 2SF, UK
    • Corresponding Author InformationCorresponding author. Tel.: +44 114 2268195.

Received 26 July 2009; received in revised form 9 September 2009; accepted 10 September 2009. published online 18 November 2009.

Article Outline

Abstract 

In mammals, Toll-like receptors (TLRs) are the principal family of innate immune pattern recognition receptors (PRRs). The main function for TLRs is the detection of molecular patterns associated with invading pathogens. We investigated TLR expression and function in three established human endometrial epithelial cell lines, including hTERT-EEC, HEC-1B and Ishikawa cells, and clarified the application of these endometrial cell lines as in vitro models for studying TLR expression and function in the female reproductive tract. TLR gene expression was examined by RT-PCR and protein localization by immunohistochemistry. Our results showed that TLR expression in these cell lines is comparable to published literature on TLR expression in primary human endometrial tissue. TLR function was investigated by the detection of IL-6 and IL-8 production by ELISA in response to TLR2, TLR3, TLR5, TLR7 and TLR9 ligands. We found that hTERT-EEC cells were responsive to TLR5 ligand and HEC-1B cells respond to TLR3 and TLR5 ligands. In contrast, Ishikawa cells respond only to PMA/I which was used as a positive control for IL-8 production. Finally, we investigated the influence of flagellin as a TLR5 stimulant on TLR5 expression in these cell lines by QPCR. Our results showed that the endometrial cell lines showed a tendency for increased TLR5 expression in response to flagellin stimulation and in hTERT-EEC cells this tendency was statistically significant. These results suggest that hTERT-EEC, HEC-1B and Ishikawa cell lines can be used as in vitro models to investigate innate immune responses of endometrial cells in the female reproductive tract.

Keywords: TLRs, Human endometrium, Epithelial cell lines

 

Back to Article Outline

1. Introduction 

The mucosal innate immune system in the female reproductive tract has evolved to meet different biological requirements. The female reproductive tract is open to the external environment and is continuously exposed to different types of pathogens. Moreover, the immune system in the female reproductive tract needs to properly react to the commensal organisms that inhabit the lower part of female reproductive tract and differentiate these microorganisms from non-resident pathogenic intruders. The number of commensal organisms might be as high as 109microorganisms/ml of vaginal fluid in a healthy woman (Quayle, 2002). Furthermore, the epithelium of the female reproductive tract has to be prepared to accommodate a broad spectrum of physiological events that include fertilization, implantation, pregnancy, and parturition (Grossman, 1985). These unique requirements make the epithelial lining of the female reproductive tract distinct from epithelia of other systems in the body, such as the digestive and respiratory systems.

During the last decade, Toll-like receptors (TLRs) have been identified as having a key role in mediating the function of innate immune system which bridge the gap between innate and adaptive immunity (Pasare and Medzhitov, 2005). TLRs are a family of membrane spanning, pattern recognition receptors (PRRs) that possess the ability to detect pathogen-associated molecular patterns (PAMPs) derived from pathogenic organisms (Akira and Hemmi, 2003, Akira and Takeda, 2004), non-pathogenic molecular patterns as observed with commensal flora (Bambou et al., 2004, Rakoff-Nahoum et al., 2004), and some endogenous ligands as danger signals (Johnson et al., 2003). In the human, ten TLR family members have been identified, TLR1, TLR2, TLR4, TLR5, TLR6 and TLR10 are expressed on the cell surface whereas TLR3, TLR7, TLR8 and TLR9 are expressed in cytoplasmic organelles, mainly the endosomes (Takeda and Akira, 2005). TLR11 is functional in mouse but not in human (Zhang et al., 2004). The intracellular endodomain toll/interleukin-1 receptor (TIR) domain is responsible for signalling events which are mediated through adaptor molecules (Takeda et al., 2003). With the exception of TLR3, all TLRs can signal through the universal adaptor molecule MyD88. TLR2 and TLR4 can act via the MyD88 adaptor-like (Mal) adaptor, while the Trif adaptor molecule mediates signalling from TLR3 and TLR4 and TRIF-related adaptor molecule (TRAM) adaptor interacts exclusively with TLR4 (Takeda and Akira, 2005). Ultimately TLR activation results in the production of different inflammatory cytokines, chemokines, and antiviral responses (Janeway and Medzhitov, 2002, Takeda et al., 2003, Takeda and Akira, 2004).

Particular cooperation between TLR family members has been observed which appears to broaden the pathogen detection capacity of TLRs. For example, TLR2 is able to act as a homodimer to recognize lipoteichoic acids of Gram-positive bacteria (Schwandner et al., 1999) but as a heterodimer with TLR1 or TLR6 to recognize triacylated lipoproteins (Takeuchi et al., 2002) and diacylated lipoproteins, respectively (Ozinsky et al., 2000, Takeuchi et al., 2001, Wetzler, 2003). Cooperation between TLRs has also been detected at the cellular level with simultaneous stimulation of more than one TLR, as demonstrated by increased TNFα production in haematopoietic cells upon concurrent stimulation of TLR2 and TLR4 (Beutler et al., 2001). There is evidence of cooperation between TLR family members and other PRRs such as Nod-like receptor (NLR) and RIG-I-like receptor (RLR), thus creating a versatile innate immune response network acting as an intricate cellular surveillance system to respond appropriately to different invading organisms (Trinchieri and Sher, 2007).

Besides their role in protection against invading microorganisms in the female reproductive tract, growing evidence suggests an important role for TLRs in mediating several interactions occurring between the immune and reproductive system. The discovery of TLRs in the female reproductive tract epithelial lining has amplified the potential clinical significance of TLRs and triggered the reappraisal of disease pathogenesis in preeclampsia, intrauterine growth retardation (IUGR), and preterm labour (Girling and Hedger, 2007). Understanding the functional roles of TLRs in the female reproductive tract is therefore of tremendous value for the reproductive health of women and will elucidate the complexity of immunological events impacting on fecundity.

Numerous obstacles limited the studies on TLR actions in the human female reproductive tract. An in vivo approach in women is preferred but ethically impossible. Obtaining primary human tissue and culturing primary cells can be done but primary cell cultures have a limited lifespan and tend to undergo cellular de-differentiation in culture (Mulholland et al., 1988). Moreover, limitation in access to female reproductive tract and inter-individual variation is another obstacle in using primary tissues for such investigations. Potential alternatives are either transgenic mouse models or immortalised cell lines. Immortalised cell lines can serve as an alternative cellular source for biomedical investigations and have the advantage of providing a constant source of a particular cell type for detailed functional studies. Examples of immortalised cell lines which have advanced our understanding of human physiology include human immortalized endocervical (End1/E6E7), ectocervical (Ect1/E6E7), and vaginal (Vk2/E6E7) epithelial cell lines (Fichorova et al., 1997), immortalized human corneal cells (Araki-Sasaki et al., 1995), immortalized human corneal endothelial cell line (Bednarz et al., 2000), and HEK 293 cells (Graham et al., 1977).

Research in understanding female reproductive tract functions has also benefited by utilising immortalised cell lines. The first human endometrial cancer cell line was established by Kuramoto in 1968 named HEC-1 cells (Kuramoto, 1972). Many human endometrial cell lines have been established since then and have been widely used for research on endometrium function in vitro, such as the Ishikawa cell line which expresses glandular epithelial cell antigens (Nishida, 2002), ECC-1 cells that have aided in understanding the phenotypes of the luminal and surface uterine epithelium (Satyaswaroop et al., 1983) and human endometrial carcinoma RL-95 cells (Way et al., 1983). These cell lines have been used as useful models for a wide range of research applications in understanding human endometrium biology and function.

The aim of the current investigation was to characterise TLR expression and function in three established human endometrial cell lines, including the telomerase immortalized human endometrial epithelial cell line hTERT-EEC (Hombach-Klonisch et al., 2005), the human endometrial adenocarcinoma cell line HEC-1B (Kuramoto, 1972) and the Ishikawa cell line (Nishida, 2002). We investigated the hypothesis that these endometrial cell lines express a spectrum of TLRs similar to primary endometrial epithelial cells. Furthermore, we examined whether stimulation of TLRs in these cell lines with TLR specific ligands will lead to the production of cytokines and/or chemokines that are involved in the inflammatory response. Finally, there are growing evidences that TLR expression is dynamic and is susceptible to changes in the extracellular environment (Abreu et al., 2001, Li et al., 2007). Here we investigated if the presence of a pathogen-associated molecular pattern (PAMP) in the culture media has a role on modulation of TLR expression in cultured cells.

Back to Article Outline

2. Materials and methods 

2.1. Antibodies, peptides and cell lines 

Antibodies and peptides used in the experiments were obtained from Santa Cruz Biotechnology Inc (CA, USA). These were goat polyclonal antibodies specific for N-terminal domains of TLR1, TLR2, TLR3, TLR5, TLR6, TLR7 and TLR9 (catalogue numbers, sc8687, sc8689, sc8691, sc8695, sc5657, sc13207 and sc 13212, respectively), goat polyclonal antibody specific for C-terminal domains of TLR4 (catalogue no. sc8694), goat polyclonal antibody specific for V-terminal domains of TLR10 (catalogue number sc 23577) and rabbit polyclonal specific for D-terminal domains of TLR8 (catalogue number sc 13212-R). Blocking peptides specific for the respective antibodies were used to determine non-specific staining.

The hTERT-EEC cell line was described previously (Hombach-Klonisch et al., 2005). HEC-1 B cells (Kuramoto, 1972) and Ishikawa cells (Nishida, 2002) were kind gifts of Dr. S. M. Laird (Sheffield Hallam University).

2.2. Immunostaining 

For immunostaining, HEC-1B cells and Ishikawa cells were cultured in twelve well plates in Dulbecco's Modified Eagles Medium (Sigma-Aldrich Company, Poole Dorset, UK) incubated at 37°C in DMEM culture media supplemented with 1% penicillin and streptomycin (Sigma–Aldrich), 10% fetal calf serum and 1% l-glutamine (Invitrogen, Paisley, UK) in 5% CO2 atmosphere into twelve well plates until confluent. hTERT-EEC cells were cultured at 37°C in DMEM (F12) (Invitrogen) supplemented with 1% penicillin and streptomycin (Sigma–Aldrich), 10% fetal calf serum (Invitrogen), 160ng/ml human recombinant insulin (Invitrogen, catalogue # 12585-014), and 1% l-glutamine (Invitrogen) in 5% CO2 atmosphere. At confluence the plates were washed three times with Ca2+ and Mg2+ DPBS (Dulbecco's phosphate-buffered saline) (Sigma), and fixed with 4% paraformaldehyde and incubated at 4°C.

Fixed plates were washed in Dulbecco's phosphate-buffered saline (DPBS) and then stained using a Vectastain Elite ABC peroxidase kit (Vector Laboratories Ltd, Peterborough, UK). To avoid non-specific binding, an avidin/biotin blocking kit was used (Vector Laboratories). Briefly, plates were blocked for 1h at room temperature in DPBS containing 0.2% v/v horse serum and 250μl/ml of avidin supplied in the blocking kit. The block was removed and the plates were incubated for 2h at room temperature in primary antibody at an appropriate dilution using antibody diluent media (Dakocytomation Ltd, Cambridgeshire, UK) containing 250μl/ml of biotin. Binding was visualized by incubation with peroxidase substrate 3-amino-9-ethylcarbazole (AEC) (Vector Laboratories) for 10min, washed in distilled water for 3min and counterstained in 10% haematoxylin for 10min. Optimum staining was achieved by using 350μl/well of 1:70 dilution of primary antibody. Negative control wells were obtained by blocking of primary antibody with the corresponding specific peptide using a 10-fold excess of blocking peptide. Immunostained plates were examined using an Olympus CX41 microscope (Olympus, London, UK) and photographed using Nikon Coolpix 5400.

2.3. Cell culture for genomic investigation 

hTERT-EEC cells were cultured at 37°C in DMEM (F12) (Invitrogen) supplemented with 1% penicillin and streptomycin, 10% fetal calf serum, 160ng/ml human recombinant insulin and 1% l-glutamine in 5% CO2 atmosphere until confluent. HEC-1B cells and Ishikawa cells were cultured at 37°C in DMEM media supplemented with 1% penicillin and streptomycin, 10% fetal calf serum and 1% l-glutamine in 5% CO2 atmosphere until confluent.

2.4. RNA isolation, cDNA synthesis and reverse transcriptase PCR (RT-PCR) 

For endometrial cell lines genomic studies, 5×106 cells were obtained from each T75 flask. Cells were washed with DPBS without Ca2+ and Mg2+, harvested using trypsin-EDTA (Invitrogen) pelleted by centrifugation at 300×g for 5min, and the supernatant was discarded. One millilitre of TRIreagent (Sigma) was added onto the pellet. Thereafter total RNA from pelleted cells was extracted following a standard protocol supplied by the manufacturer.

Total RNA obtained from hTERT-EEC cells, HEC-1B cells and Ishikawa cells was treated three times with DNase I (DNA-free™, Ambion Austin, TX, USA) to remove genomic DNA contamination from the samples. First strand cDNA synthesis was performed using oligo dT primers (Metabion, Martinsried, Germany) and reverse transcription by SuperScript II (200U/μl; Invitrogen). Negative controls were prepared without inclusion of the enzyme (non-reverse transcribed controls, RT controls). The RT-PCR was performed by combining cDNA, Platinum Blue PCR Super Mix (Invitrogen) and the forward and reverse primers for TLR1-10 (Metabion). The forward and reverse primer sequences used are depicted in Table 1. The amplification was continued for 40 cycles under the following conditions: 95° for 30s, 59–65° (see Table 1) for 1min, 72° for 2min. All experiments included RT controls as negative controls (no cDNA). To separate PCR products 10μl of each sample was resolved on a 1.2% agarose gel and electrophoresis was performed with 1x TAE buffer and a voltage of 110V for 40–50min. The bands were visualized by using an ultraviolet transillumination, and digital images were obtained. The amplified PCR products were sequenced to confirm the identity of the amplified product.

Table 1. Sequence of TLR primers used in the current investigation in RT-PCR, data obtained from other reports are referenced.
GeneForward primer (5′–3′)Reverse primer (3′–5′)Annealing temperature (°C)Accession NoProd size (bp)Reference
TLR1GGGTCAGCTGGACTTCAGAGAAAATCCAAATGCAGGAACG61U88540.1250Aflatoonian et al. (2007)
TLR2TCGGAGTTCTCCCAGTTCTCTTCCAGTGCTTCAACCCACAA59AF051152.1175Aflatoonian et al. (2007)
TLR3CGGGCCAGCTTTCAGGAACCTGGGCATGAATTATATATGCTGC59U88879.1400Schaefer et al. (2004)
TLR4CGTGGAGACTTGGCCCTAAATTCACACCTGGATAAATCCAGC59U88880.1301Aflatoonian et al. (2007)
TLR5CCTCATGACCATCCTCAC AGTCACGGCTTCAAGGCACCAGCC ATCTC65AF051151.1355Schaefer et al. (2004)
TLR6CCAAGTGAACATATCAGTTAATACTTTAGGGTGCCTCAGAAAACACGGTGTAC AAAGCTG63AB020807.1358Schaefer et al. (2004)
TLR7CCTTGAGGCCAACAACATCTGTAGGGACGGCTGTGACATT65AF240467.1285Aflatoonian et al. (2007)
TLR8GTCCTGGGGATCAAAGAGG GAAGAGGTAGGGACGGCTGTGACATT63AK075117.1581Schaefer et al. (2004)
TLR9GCGAGATGAGGATGCCCTG CCCTACGTTCGGCCGTGGGTCCCTGGC AGAAG70AY359085.1510
TLR10CAGAGGTCATGATGGTTG GATGGGACCTAGCATCCTGAGATAC CAGGGCAG63AY358300.1256Schaefer et al. (2004)
β-ActinCAAGATCATTGCTCCTCCTGATCCACATCTGCTGGAAGG60NM_00110190

2.5. Stimulation of hTERT-EEC cells, HEC-1B cells and Ishikawa cells with TLR2, TLR3, TLR5, TLR7 and TLR9 ligands 

To study the functionality of TLR2, TLR3, TLR5, TLR7 and TLR9 in endometrial cell lines, cells were exposed to the TLR2, TLR3, TLR5, TLR7 and TLR9 specific ligands peptidoglycan, polyinosinic–polycytidylic acid, flagellin, Loxoribine and CPG oligonucleotide, respectively. Phorbol 12-myristate 13-acetate (PMA) (Sigma, No. P8139) plus ionomycin (Sigma, No 13909) were used as a positive control in this experiment (10ng/ml PMA and 500ng/ml ionomycin). Cells were cultured in 12-well culture plates until they were confluent. The supernatant was then replaced with 1ml of fresh culture medium containing TLR2, TLR3, TLR7 and TLR9 ligands, peptidoglycan from Staphylococcus aureus (10μg/ml; catalog # tlr1-pgnsa), poly I:C (25μg/ml; catalog # tlr1-pic), Loxoribine (100μM; catalog # tlr1-lox) and CPG oligonucleotide ODN1826 (5μM;, catalog # tlr1-modn) (all Invitrogen). Different concentrations of these ligands were tested (data not shown). Cells were incubated for 24h and supernatants were collected, centrifuged at 10,000×g for 5min at 4°C, transferred to fresh tubes and stored at −70°C.

To clarify the effect of flagellin stimulation on TLR5 function in our endometrial cell lines, cells were cultured in 12-well culture plates until near confluence. Cells were incubated in serum-free medium overnight. The supernatants were replaced with 1ml of fresh serum-free culture medium containing TLR5 ligand (purified flagellin from Salmonella typhimurium, 100ng/ml) for 24h. Culture medium was collected, centrifuged at 10,000×g for 5min at 4°C, transferred to fresh tubes, and stored at −70°C until used. To screen the effect of flagellin dose concentration on TLR5 function in hTERT-EEC cells, IL-8 production levels were tested in response to treatment with different flagellin concentrations (0, 1, 10, 100, 200, 500 and 1000ng/ml) for 24h. Culture supernatants were treated as described above and stored at −70°C. Each experiment was performed in triplicate.

The concentrations of IL-6 and IL-8 were determined in culture supernatants with commercially available IL-6 and IL-8 sandwich ELISA Duoset kits (R&D Systems, Minneapolis, MN, USA). The ELISA was performed according to the manufacturer instructions with 100μl of cell-free supernatant. ELISA assay which in our hands had a sensitivity of 18.75 and 8pg/ml for IL-6 and IL-8 respectively. Sample concentrations were determined with interpretation from the standard curve.

2.6. Analysis of cytokines and chemokines induced by flagellin using Cytometric Bead Array (CBA) 

The three cell lines were cultured in twelve well plates as above. Near confluence, media were replaced with serum-free media, thereafter cells were stimulated with 100ng/ml of flagellin for 24h. To characterise any elevation in cytokines and chemokines in response to flagellin stimulation, 25μl of cell-free culture supernatant was analysed using a multiplex Cytometric Bead Array (BD Biosciences, San Jose, CA, USA). Beads internally dyed with varying intensities of a proprietary fluorophore and coated with capture antibodies specific to a cytokine or chemokine were incubated with 25μl of cell supernatant for 1h. Twenty-five microlitres of a secondary phycoerythrin-labelled antibody was then added and incubated for 2h. The beads were then washed and samples were analysed by FACSArray™ Bioanalyser. (San Jose, CA, USA). The data were analysed with FCAP Array™ software provided by Soft Flow, Inc. USA, and sample concentrations were determined. The tested cytokines and chemokines were IL-1α, IL-1β, IFNγ, IL-3, IL-6, IL-8, IL-10, IL-12, IL-13, MCP-1 and TNFα. The level of sensitivity was 10–2500pg/ml.

2.7. Functional blocking of TLR5 and TLR3 

To show that the detected responses to flagellin stimulation in hTERT-EEC cells and HEC-1B cells were mediated through TLR5, these cell lines were exposed to anti-TLR5 polyclonal antibody (Invitrogen) at a final concentration of 3μg/ml for 10min at 37°C and then stimulated with 100ng/ml of flagellin for 24h. Supernatants were then collected and the IL-8 response was quantified by ELISA.

To determine if the elevated cytokine reaction to poly I:C in HEC-1B cells was mediated by TLR3, these cells were exposed to TLR3 function-blocking antibody. The HEC 1B cell line was pre-treated with anti-TLR3 monoclonal antibody (Santa Cruz Biotechnology) at a final concentration of 20μg/ml for 1h at 37°C, then stimulated with poly I:C (25μg/ml for 24h). Supernatants were then collected and the IL-8 response was quantified by ELISA.

2.8. Alteration in TLR5 expression in response to flagellin stimulation 

To investigate any alteration of TLR5 gene expression in response to flagellin stimulation, hTERT-EEC cells, HEC-1B cells and Ishikawa cells were cultured in T75 flasks as above. Before the cells reached confluency, they were serum-starved for 24h and then treated with 100ng/ml flagellin. Twenty-four hours after treatment with flagellin the culture supernatant was discarded and cells were washed with DPBS without Ca2+ and Mg2+ and harvested using trypsin-EDTA. Cells were pelleted by centrifugation at 300×g and total RNA was extracted from pelleted cells and cDNA synthesis was performed as above. The experiment was done in triplicate.

2.9. Quantitative real time PCR (QPCR) 

QPCR was carried out with the cDNA prepared from cells treated with and without flagellin. Intron-spanning TLR5 primers were designed for QPCR to exclude amplification from genomic DNA template. The primer sequence was CACCAAACCAGGGATGCTAT for the forward sequence and CCTGTGTATTGATGGGCAAA for the reverse sequence, and product size was 111bp. For normalization purposes, expression of the reference housekeeping gene β-actin was also quantified using primer sequences CAAGATCATTGCTCCTCCTG for the forward sequence and ATCCACATCTGCTGGAAGG for the reverse sequence, and product size was 90bp (Aflatoonian et al., 2007). SYBR Green Jump Start (Sigma) master mix (containing 10μl SYBR Green, 7μl H2O, 1μl of TLR5 or β-actin primers and 1μl cDNA) was added to each well of PCR plate and amplification was performed under the following conditions: 40 cycles of 95° for 30s, 59° for 30s and 72° for 30s. All experiments included RT controls and negative controls (no cDNA). QPCR was performed using Mx3005P QPCR (Stratagene, Waldbronn, Germany) and results were analyzed using MxPro QPCR software version 4.01.

2.10. Statistical analysis 

The QPCR data were analyzed using the comparative CT method. Briefly, the difference in cycle time (ΔCT) was determined as the difference between the number of cycles required for amplification of the test gene and β-actin. We then obtained ΔΔCT by finding the difference between groups (Livak and Schmittgen, 2001). The results were expressed as mean±SEM. Statistical analysis was performed by using ANOVA with Tukey's multiple comparison test. P<0.05 was considered significant.

Back to Article Outline

3. Results 

3.1. Immunostaining for TLR protein in endometrial cell lines 

Positive immunostaining was detected for TLR1-3 and TLR5-10 in hTERT-EEC cells, for all TLRs in HEC-1B cells and for TLR1-9 in Ishikawa cells. TLRs stained weakly in the endometrial cell lines tested, apart from TLR5 and TLR8 which stained strongly. Immunodetection of TLRs was specific since blocking of the primary antibodies with their respective blocking peptides markedly reduced the staining as depicted in top inserts (Fig. 1A–C).

  • View full-size image.
  • View full-size image.
  • Fig. 1. 

    Immunohistochemical staining of TLR1-10 protein in (A) hTERT-EEC cells, (B) HEC-1B cells and (C) Ishikawa cells. Positive staining is red; nuclei were counterstained with hematoxylin in (A). Inserts show blocking of anti-TLR antibody binding by their respective specific blocking peptides resulting in markedly decreased immunostaining.

3.2. RT-PCR for TLR mRNA expression in endometrial cell lines 

RT-PCR was performed to detect mRNA gene expression for TLRs 1-10 in hTERT-EEC cells, HEC-1B cells and Ishikawa cells. TLR gene expression was positive in hTERT-EEC cells for TLR1-3 and TLR5-10, in HEC-1B cells for TLR1-10 and in Ishikawa cells for TLR1-9. All amplified products were at the predicted size for their respective genes. There was no product amplified in control samples, indicative of the absence of genomic DNA contamination. The identity of all amplicons was confirmed by sequencing. Table 2 shows the results of RT-PCR for mRNA expression of TLR1-10 genes in the endometrial cell lines and those reported for primary tissue by others.

Table 2. Results of RT-PCR for mRNA expression of TLR1-10 genes in the endometrial cell lines investigated in the current study and primary tissue and cells reported in literature, (+) indicates positive TLR expression where (−) indicates negative expression.
Tissue/cell line typeTLR1TLR2TLR3TLR4TLR5TLR6TLR7TLR8TLR9TLR10
Primary tissue (Aflatoonian et al., 2007)++++++++++
Primary epithelial cells (Schaefer et al., 2004)+++++++++−
Primary epithelial cells (Young et al., 2004)++++++−−+−
hTERT-EECs+++−++++++
HEC-1B++++++++++
Ishikawa+++++++++−

3.3. TLR2, TLR3, TLR5, TLR7 and TLR9 signalling in endometrial cell lines 

The effect of stimulation with peptidoglycan, poly (I:C), flagellin, Loxoribine and CPG oligonucleotide in endometrial cell lines was examined by measuring the IL-6 and IL-8 response using cytokine-specific ELISA. There was no detectable production of IL-6 in response to the tested ligands in the three cell lines (data not shown). However, IL-8 was increased in hTERT-EEC cells in response to flagellin stimulation. In HEC-1B cells, IL-8 was increased in response to poly (I:C) and to flagellin stimulation. No IL-8 was detected in Ishikawa cells in response to the tested ligands. On the other hand, all the cell lines produced IL-8 in response to PMA and ionomycin stimulation which was used as a positive control treatment (Fig. 2A–C).

  • View full-size image.
  • Fig. 2. 

    Production of IL-8 in response to TLR ligands in hTERT-EEC cells (A), HEC-1B cells (B) and Ishikawa cells (C). Cells were treated with peptidoglycan from Staphylococcus aureus (10μg/ml); poly (I:C) (25μg/ml); flagellin purified from S. typhimurium (100ng/ml); Loxoribine (100μM) or CPG oligonucleotide (5μM). Phorbol 12-myristate 13-acetate (PMA; 10ng/ml) plus Ionomycin (I; 500ng/ml) was used as a positive control in this experiment. Because of omission of serum from the media in wells treated with flagellin, an additional control was included (no flagellin). Supernatants were collected following 24h of ligand stimulation and analysed for IL-8 production by ELISA. The results show the mean of three independent experiments and the error bar represents the SEM. Data were analysed by ANOVA followed by Tukey's multiple comparison test. *P<0.05 compared with no stimulation control treatment.

3.4. Flagellin dose response on TLR5 signalling in hTERT-EEC cells 

In hTERT-EEC cells there was a significant increase in IL-8 production in response to increasing concentrations of flagellin (0, 1, 10, 100ng/ml), with no further increase in IL-8 production observed with higher flagellin concentrations (200, 500 and 1000ng/ml) (Fig. 3). Thus, further investigations on the effect of flagellin on TLR5 function were performed with 100ng/ml flagellin.

  • View full-size image.
  • Fig. 3. 

    Effect of flagellin concentration on IL-8 production in hTERT-EEC cells. Cells were incubated in serum-free media with flagellin (0, 1, 10, 100, 200, 500 and 1000ng/ml), and supernatants were collected 24h later and analysed for IL-8 content by ELISA. IL-8 production was significantly increased after treatment with 100, 200, 500 and 1000ng/ml concentrations of flagellin, compared to the 0, 1 and 10ng/ml concentrations. No significant difference in IL-8 production could be detected between the 100, 200, 500 and 1000ng/ml flagellin treatments. The results show the mean±SEM of three independent experiments. Data were analysed by ANOVA followed by Tukey's multiple comparison test. *P<0.05 compared with no flagellin control treatment.

3.5. Responses to flagellin stimulation in endometrial cells measured by Cytometric Bead Array 

Measurement of 11 cytokines and chemokines by Cytometric Bead Array showed elevation of IL-8 and monocyte chemotactic protein (MCP)-1 production in response to flagellin stimulation in hTERT-EEC cells and HEC-1B cells. The other cytokines and chemokines tested including IL-1α, IL-1β, IFNγ, IL-3, IL-6, IL-10, IL-12, IL-13 and TNFα were all below the detection limit. In the Ishikawa cells no elevation of these cytokines and chemokines could be detected in response to flagellin stimulation (Fig. 4).

  • View full-size image.
  • Fig. 4. 

    Effect of flagellin treatment on cytokine and chemokine production as measured by BD™ Cytometric Bead Array. HEC-1B cells (■), Ishikawa cells (□) and hTERT-EEC cellss () were exposed for 24h to 100ng/ml flagellin and cell-free supernatants were analysed to detect IL-1α, IL-1β, IFNγ, IL-3, IL-6, IL-8, IL-10, IL-12, IL-13, MCP-1 and TNFα. In HEC-1B cells and hTERT-EEC cells, IL-8 and MCP-1 responses were detected, whereas in Ishikawa cells no response to flagellin stimulation was detected.

3.6. Blocking TLR5 and TLR3 function with specific antibodies 

Pre-treatment of hTERT-EEC cells and HEC-1B cells with TLR5 function-blocking antibody completely inhibited the flagellin-induced IL-8 response in these cell lines. Incubation of HEC-1B cells with a TLR3 function-blocking antibody also markedly reduced the flagellin-induced increase in IL-8 production (Fig. 5).

  • View full-size image.
  • Fig. 5. 

    Effect of pre-treatment with function-blocking anti-TLR5 and anti-TLR3 antibodies. The effect of anti-TLR5 polyclonal antibody on IL-8 protein expression in response to flagellin stimulation in (A) hTERT-EEC cells and (B) HEC-1B cells was investigated. Cells were incubated with anti-TLR5 polyclonal antibody at a final concentration of 3μg/ml for 10min at 37°C. Thereafter, cells were stimulated with 100ng/ml of flagellin for 24h. Supernatants were collected and analysed for IL-8 production by ELISA. F100=100ng/ml flagellin, B=TLR blocking antibody, C=control (no flagellin added) and P=poly (I:C). (C) HEC-1B cells were treated with anti-TLR3 monoclonal antibody for 1h at a final concentration of 20μg/ml at 37°C, and cells were then stimulated with 25μg/ml of poly(I:C) for 24h. Supernatants were collected and analysed for IL-8 production by ELISA. The results shown are the Mean±SEM of three independent experiments. Data were analysed by ANOVA followed by Tukey's multiple comparison test. *P<0.05 compared with no flagellin control treatment.

3.7. Alteration in TLR5 mRNA expression in response to flagellin stimulation in endometrial cell lines 

hTERT-EEC cells, HEC-1B cells and Ishikawa cells all showed an increase in TLR5 mRNA expression in response to stimulation with 100ng/ml of flagellin. However, the increase in TLR5 expression was statistically significant only in hTERT-EEC cells (Fig. 6).

  • View full-size image.
  • Fig. 6. 

    QPCR was used to quantify the expression of TLR5 mRNA in response to 100ng/ml flagellin stimulation for 24h. Data are presented as mean±SEM of normalised expression values against endogenous control (β-actin mRNA) in hTERT-EEC cells (A), HEC-1B cells (B) and Ishikawa cells (C). TLR5 expression was significantly increased in hTERT-EEC cells in the presence of flagellin (■), compared to control (). The results shown are the Mean±SEM of three independent experiments. Data were analysed by ANOVA followed by Tukey's multiple comparison test. *P<0.05 compared with no flagellin control treatment.

Back to Article Outline

4. Discussion 

The endometrium is a unique tissue that shows cyclic regeneration during each menstrual cycle throughout a woman's reproductive life. The growth and shedding of the endometrium requires the coordinated proliferation and maturation of epithelial, stromal, and endothelial/vascular tissue in the endometrial compartment. In humans, these cyclic endometrial changes establish the receptivity of the uterus for anticipated pregnancy. To better understand the role of innate immunity in mediating immune responses in the human endometrium, we have characterized the presence and function of TLRs in three endometrial cell lines and showed that these cell lines are suitable tools for investigating the role of TLRs in the female reproductive tract.

Primary endometrial tissues were reported to express TLR1-10 (Aflatoonian et al., 2007) which was similar to the TLR gene expression profile we observed in the HEC-1B cell line. The hTERT-EEC and Ishikawa cell lines lacked gene expression for TLR4 and TLR10 respectively, and this may be as a result of the immortalization process. The study performed by Schaefer and colleagues in primary human endometrial epithelial cell cultures showed positive TLR1-9 and negative TLR10 expression (Schaefer et al., 2005). Thus, positive expression of TLR10 observed in primary endometrial tissue but not in isolated epithelial cells could be attributed to the presence of different cell types, in addition to epithelial cells, in primary endometrial tissue. TLRs are expressed in a cell type-specific fashion. A recent study on bovine endometrium identified altered TLR expression between endometrial epithelial and stromal cells. They showed positive expression for TLR1-7 and TLR9 in epithelial cells and TLR1-4, TLR6, TLR7, TLR9 and TLR10 in stromal cells (Davies et al., 2008). Itoh and colleagues reported a difference in TLR expression between cultured oviductal epithelial cells and stromal fibroblasts. TLR4 gene expression was not present in cultured oviductal epithelial cells but was present in oviductal stromal fibroblasts. The authors speculated that epithelial cells and fibroblasts in the human fallopian tube may provide a site-specific mechanism for LPS detection (Itoh et al., 2006). If such a variation in TLR expression indeed exists in different sites of the female reproductive tract, further investigations are needed to understand the significance of this variation in mediating innate immunity in the female reproductive tract. Table 2 demonstrates the variable results of TLR expression in the cell lines studied in the current investigation and in primary tissues investigated by others. In the majority of cases, TLRs expression in these cell lines was similar to that reported in primary endometrial tissue. Hence, these cell lines can be considered as suitable models for further investigation of the role of TLRs in the female reproductive tract.

Young and colleagues reported positive expression for TLR2 and TLR5 in the Ishikawa cell line (Young et al., 2004). We confirmed these data and demonstrated the absence of TLR10 in this cell line. In addition to their findings, we also detected TLR1, TLR3, TLR4 and TLR6-9 mRNAs in this cell line and validated this by sequencing RT-PCR products. The differences could be attributed to the TLR primers and PCR conditions used in the two laboratories. None of our PCR negative controls showed an amplified product, thus confirming the absence of genomic DNA contamination in our test samples.

We have previously demonstrated the presence and localization of immunoreactive TLR1-6 protein in various primary tissues in the female reproductive tract (Fazeli et al., 2005) and of TLR7-10 protein in primary human endometrial tissues (Aflatoonian et al., 2007). Here, we provide further information on TLR synthesis in human endometrial cell lines. Our immunostaining results mirrored the TLR gene expression data. Immunostaining was positive for TLR1-3 and TLR5-10 in hTERT-EEC cells, for TLR1-10 in HEC-1B cells, and for TLR1-9 in Ishikawa cells. Immunostaining was most distinct for TLR5 and TLR8 in all endometrial cell lines tested. Incubation of tissues with primary antibodies in the presence of their respective blocking peptides markedly reduced their staining, confirming the specificity of the primary antibodies used in our experiments.

Whereas TLR expression in hTERT-EEC cells, HEC-1B cells, and Ishikawa cells was somewhat predictable, the non-responsiveness of TLRs in these cell lines to most of their specific ligands was surprising. An increase in IL-8 production was detected in hTERT-EEC cells and HEC-1B cells in response to flagellin stimulation and in HEC-1B cells in response to poly (I:C) stimulation. IL-8 production in Ishikawa cells was detected only after exposure of these cells to PMA and ionomycin, which confirmed the ability of this cell line to produce IL-8. Thus, although the epithelial cell lines investigated expressed TLRs, the functional response was not concurrent with signalling function of the identified TLR molecules. This observation interestingly was observed with the primary endometrial epithelial cells as well, where the study performed on primary endometrial epithelial cells demonstrated exclusive responsiveness to TLR3 ligand despite being positive for TLR1-9 expression (Schaefer et al., 2005). Further, the endometrial epithelial cell line ECC-1 showed positive expression for TLR1-9 but the functional responses were only detected when these cells were stimulated with TLR2 and 5 specific ligands and, to a lesser extent, with TLR4 ligand (Schaefer et al., 2004). The cellular response to TLR ligands may necessitate the presence of TLR associated adaptor proteins, cofactors, and signalling/accessory molecules. Some cofactors essential for the function of specific TLRs may be missing in a specific cell line which results in impaired functionality of particular TLR molecules. The necessity for the presence of CD14 (Aderem and Ulevitch, 2000) and MD2 (Miyake, 2004) for LPS to activate TLR4 function has been shown. Alternatively, the absence of TLR responses in our study might reflect the fact that these TLRs are in fact active but induce the production of certain cytokines and/or chemokines not detected in our experiments. Alternatively the response to TLR ligands may be mediated via different pathways entirely. Trophoblast cell activation in response to TLR2 ligand resulted in the apoptosis of the trophoblast cells and did not result in cytokine release (Abrahams et al., 2004). A similar response could partially explain our inability to detect TLR responses to their specific ligands in the cell lines studied here.

Our finding confirms that the Ishikawa cell line can produce IL-8 but fails to respond to TLR2, TLR3, TLR5, TLR7 and TLR9 ligand stimulation. This finding was in agreement with the study of Young et al. (Young et al., 2004). The only known ligand for TLR5is flagellin, a highly immunogenic molecule expressed in flagellated gram-positive and gram-negative bacteria. Despite the important role of TLR5 in mediating innate immunity via the TLR system, limited knowledge exists about TLR5 function in the female reproductive tract. At present, it remains obscure why flagellin does not stimulate TLR5 in Ishikawa cells. The source of flagellin used by us and by Young and colleagues was purified flagellin from S. typhimurium. It has been reported that cells react distinctly to flagellin from different sources, for example human corneal epithelial cells respond to flagellin derived from Pseudomonas aeruginosa and fail to respond to flagellin purified from S. typhimurium (Hozono et al., 2006). Future investigations are needed to determine if TLR5 in Ishikawa cells is stimulated in a different manner in response to different sources of flagellin. Post-translational modifications of TLRs may also interfere with flagellin binding. In Caco-2 and HEK 293T epithelial cells, interaction between TLR5 and flagellin from entero-aggregative Escherichia coli requires the phosphorylation of TLR5 by protein kinase D (Ivison et al., 2007).

TLR expression is a dynamic process and susceptible to changes in the extracellular environment (Li et al., 2007). Both the expression and the function of TLR in intestinal epithelial cells are altered and controlled by the presence of bacterial stimuli. Flagellin stimulation up-regulated TLR2, TLR4 and TLR5 expression in an intestinal epithelial cell line (mICc12) (Van Aubel et al., 2007). In human peripheral blood mononuclear cells and monocytes, stimulation with various TLR ligands caused alterations in TLR expression (Cabral et al., 2006). Stimulation of TLR2 resulted in up-regulation of TLR1 and TLR2 and in down-regulation of TLR5 expression, but TLR4 stimulation showed no effect on TLR1, TLR2 and TLR5 expression. In the endometrial cell lines used in the current experiment, TLR5 stimulation acted to up-regulate TLR5 expression. However, increased TLR5 gene expression in response to flagellin stimulation was significant only in hTERT-EEC cells. These findings indicate that presence of the same stimulus might result in variable effects on TLR expression in distinct cell types and these variations could be beneficial for either the host and/or the infectious agent (Cabral et al., 2006). Our findings point to a potential role of flagellin as a stimulant for the human endometrial immune response, which confirms a previous report (Lee et al., 2006).

Taken together our data demonstrated that hTERT-EEC, HEC-1B and Ishikawa cell lines are suitable in vitro models for endometrial epithelial cells to study TLR regulation and function and to assist in understanding the mediation of innate immunity in the female reproductive tract. However, like all in vitro cell line models, it is important to note that the cell lines used in this study clearly have limitations in their ability to exactly mimic the in vivo response.

Back to Article Outline

References 

  1. Abrahams VM, Bole-Aldo P, Kim YM, Straszewski-Chavez SL, Chaiworapongsa T, Romero R, et al. Divergent trophoblast responses to bacterial products mediated by tlrs. J. Immunol. 2004;173:4286–4296
  2. Abreu MT, Vora P, Faure E, Thomas LS, Arnold ET, Arditi M. Decreased expression of toll-like receptor-4 and md-2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopolysaccharide. J. Immunol. 2001;167:1609–1616
  3. Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response. Nature. 2000;406:782–787
  4. Aflatoonian R, Tuckerman E, Elliott SL, Bruce C, Aflatoonian A, Li TC, et al. Menstrual cycle-dependent changes of toll-like receptors in endometrium. Hum. Reprod. 2007;22:586–593
  5. Akira S, Hemmi H. Recognition of pathogen-associated molecular patterns by tlr family. Immunol. Lett. 2003;85:85–95
  6. Akira S, Takeda K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004;4:499–511
  7. Araki-Sasaki K, Ohashi Y, Sasabe T, Hayashi K, Watanabe H, Tano Y, et al. An sv40-immortalized human corneal epithelial cell line and its characterization. Invest. Ophthalmol. Vis. Sci. 1995;36:614–621
  8. Bambou JC, Giraud A, Menard S, Begue B, Rakotobe S, Heyman M, et al. In vitro and ex vivo activation of the tlr5 signaling pathway in intestinal epithelial cells by a commensal Escherichia coli strain. J. Biol. Chem. 2004;279:42984–42992
  9. Bednarz J, Teifel M, Friedl P, Engelmann K. Immortalization of human corneal endothelial cells using electroporation protocol optimized for human corneal endothelial and human retinal pigment epithelial cells. Acta Ophthalmol. Scand. 2000;78:130–136
  10. Beutler E, Gelbart T, West C. Synergy between tlr2 and tlr4: a safety mechanism. Blood Cells Mol. Dis. 2001;27:728–730
  11. Cabral ES, Gelderblom H, Hornung RL, Munson PJ, Martin R, Marques AR. Borrelia burgdorferi lipoprotein-mediated tlr2 stimulation causes the down-regulation of tlr5 in human monocytes. J. Infect. Dis. 2006;193:849–859
  12. Davies D, Meade KG, Herath S, Eckersall PD, Gonzalez D, White JO, et al. Toll-like receptor and antimicrobial peptide expression in the bovine endometrium. Reprod. Biol. Endocrinol. 2008;6:53
  13. Fazeli A, Bruce C, Anumba DO. Characterization of toll-like receptors in the female reproductive tract in humans. Hum. Reprod. 2005;20:1372–1378
  14. Fichorova RN, Rheinwald JG, Anderson DJ. Generation of papillomavirus-immortalized cell lines from normal human ectocervical, endocervical, and vaginal epithelium that maintain expression of tissue-specific differentiation proteins. Biol. Reprod. 1997;57:847–855
  15. Girling JE, Hedger MP. Toll-like receptors in the gonads and reproductive tract: emerging roles in reproductive physiology and pathology. Immunol. Cell Biol. 2007;85:481–489
  16. Graham FL, Smiley J, Russell WC, Nairn R. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol. 1977;36:59–74
  17. Grossman CJ. Interactions between the gonadal steroids and the immune system. Science. 1985;227:257–261
  18. Hombach-Klonisch S, Kehlen A, Fowler PA, Huppertz B, Jugert JF, Bischoff G, et al. Regulation of functional steroid receptors and ligand-induced responses in telomerase-immortalized human endometrial epithelial cells. J. Mol. Endocrinol. 2005;34:517–534
  19. Hozono Y, Ueta M, Hamuro J, Kojima K, Kawasaki S, Yamazaki K, et al. Human corneal epithelial cells respond to ocular-pathogenic, but not to nonpathogenic-flagellin. Biochem. Biophys. Res. Commun. 2006;347:238–247
  20. Itoh H, Nasu K, Nishida M, Matsumoto H, Yuge A, Narahara H. Human oviductal stromal fibroblasts, but not oviductal epithelial cells, express toll-like receptor 4: the site-specific mucosal immunity of the human fallopian tube against bacterial infection. Am. J. Reprod. Immunol. 2006;56:91–101
  21. Ivison SM, Graham NR, Bernales CQ, Kifayet A, Ng N, Shobab LA, et al. Protein kinase d interaction with tlr5 is required for inflammatory signaling in response to bacterial flagellin. J. Immunol. 2007;178:5735–5743
  22. Janeway CA, Medzhitov R. Innate immune recognition. Annu. Rev. Immunol. 2002;20:197–216
  23. Johnson GB, Brunn GJ, Platt JL. Activation of mammalian toll-like receptors by endogenous agonists. Crit. Rev. Immunol. 2003;23:15–44
  24. Kuramoto H. Studies of the growth and cytogenetic properties of human endometrial adenocarcinoma in culture and its development into an established line. Acta Obstet. Gynaecol. Jpn. 1972;19:47–58
  25. Lee SE, Kim SY, Jeong BC, Kim YR, Bae SJ, Ahn OS, et al. A bacterial flagellin, vibrio vulnificus flab, has a strong mucosal adjuvant activity to induce protective immunity. Infect. Immun. 2006;74:694–702
  26. Li J, Shen J, Beuerman RW. Expression of toll-like receptors in human limbal and conjunctival epithelial cells. Mol. Vis. 2007;13:813–822
  27. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods. 2001;25:402–408
  28. Miyake K. Endotoxin recognition molecules, toll-like receptor 4-md-2. Semin. Immunol. 2004;16:11–16
  29. Mulholland J, Winterhager E, Beier HM. Changes in proteins synthesized by rabbit endometrial epithelial cells following primary culture. Cell Tissue Res. 1988;252:123–132
  30. Nishida M. The Ishikawa cells from birth to the present. Hum. Cell. 2002;15:104–117
  31. Ozinsky A, Underhill DM, Fontenot JD, Hajjar AM, Smith KD, Wilson CB, et al. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between toll-like receptors. Proc. Natl. Acad. Sci. U.S.A. 2000;97:13766–13771
  32. Pasare C, Medzhitov R. Toll-like receptors: linking innate and adaptive immunity. Adv. Exp. Med. Biol. 2005;560:11–18
  33. Quayle AJ. The innate and early immune response to pathogen challenge in the female genital tract and the pivotal role of epithelial cells. J. Reprod. Immunol. 2002;57:61–79
  34. Rakoff-Nahoum S, Paglino J, Eslami-Varzaneh F, Edberg S, Medzhitov R. Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell. 2004;118:229–241
  35. Satyaswaroop PG, Zaino RJ, Mortel R. Human endometrial adenocarcinoma transplanted into nude mice: growth regulation by estradiol. Science. 1983;219:58–60
  36. Schaefer TM, Desouza K, Fahey JV, Beagley KW, Wira CR. Toll-like receptor (tlr) expression and tlr-mediated cytokine/chemokine production by human uterine epithelial cells. Immunology. 2004;112:428–436
  37. Schaefer TM, Fahey JV, Wright JA, Wira CR. Innate immunity in the human female reproductive tract: antiviral response of uterine epithelial cells to the tlr3 agonist poly(I:C). J. Immunol. 2005;174:992–1002
  38. Schwandner R, Dziarski R, Wesche H, Rothe M, Kirschning CJ. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2. J. Biol. Chem. 1999;274:17406–17409
  39. Takeda K, Akira S. Tlr signaling pathways. Semin. Immunol. 2004;16:3–9
  40. Takeda K, Akira S. Toll-like receptors in innate immunity. Int. Immunol. 2005;17:1–14
  41. Takeda K, Kaisho T, Akira S. Toll-like receptors. Annu. Rev. Immunol. 2003;21:335–376
  42. Takeuchi O, Kawai T, Muhlradt PF, Morr M, Radolf JD, Zychlinsky A, et al. Discrimination of bacterial lipoproteins by toll-like receptor 6. Int. Immunol. 2001;13:933–940
  43. Takeuchi O, Sato S, Horiuchi T, Hoshino K, Takeda K, Dong Z, et al. Cutting edge: role of toll-like receptor 1 in mediating immune response to microbial lipoproteins. J. Immunol. 2002;169:10–14
  44. Trinchieri G, Sher A. Cooperation of toll-like receptor signals in innate immune defence. Nat. Rev. Immunol. 2007;7:179–190
  45. Van Aubel RA, Keestra AM, Krooshoop DJ, Van Eden W, Van Putten JP. Ligand-induced differential cross-regulation of toll-like receptors 2, 4 and 5 in intestinal epithelial cells. Mol. Immunol. 2007;44:3702–3714
  46. Way DL, Grosso DS, Davis JR, Surwit EA, Christian CD. Characterization of a new human endometrial carcinoma (rl95-2) established in tissue culture. In vitro. 1983;19:147–158
  47. Wetzler LM. The role of toll-like receptor 2 in microbial disease and immunity. Vaccine. 2003;21(Suppl. 2):S55–S60
  48. Young SL, Lyddon TD, Jorgenson RL, Misfeldt ML. Expression of toll-like receptors in human endometrial epithelial cells and cell lines. Am. J. Reprod. Immunol. 2004;52:67–73
  49. Zhang D, Zhang G, Hayden MS, Greenblatt MB, Bussey C, Flavell RA, et al. A toll-like receptor that prevents infection by uropathogenic bacteria. Science (New York, NY). 2004;303:1522–1526

PII: S0165-0378(09)00499-9

doi:10.1016/j.jri.2009.09.008

Journal of Reproductive Immunology
Volume 84, Issue 1 , Pages 41-51, January 2010

Article Tools

* Image Usage & Resolution