Journal of Reproductive Immunology
Volume 84, Issue 1 , Pages 66-74, January 2010

Gene transcription of TLR2, TLR4, LPS ligands and prostaglandin synthesis enzymes are up-regulated in canine uteri with cystic endometrial hyperplasia–pyometra complex

  • E. Silva

      Affiliations

    • Interdisciplinary Centre of Research in Animal Health, Faculty of Veterinary Medicine, TULisbon, Av. da Universidade Técnica, Alto da Ajuda, Polo Universitário, 1300-477 Lisboa, Portugal
    • ,
  • S. Leitão

      Affiliations

    • Interdisciplinary Centre of Research in Animal Health, Faculty of Veterinary Medicine, TULisbon, Av. da Universidade Técnica, Alto da Ajuda, Polo Universitário, 1300-477 Lisboa, Portugal
    • ,
  • S. Henriques

      Affiliations

    • Interdisciplinary Centre of Research in Animal Health, Faculty of Veterinary Medicine, TULisbon, Av. da Universidade Técnica, Alto da Ajuda, Polo Universitário, 1300-477 Lisboa, Portugal
    • ,
  • M.P. Kowalewski

      Affiliations

    • Clinic for Obstetrics, Gynecology und Andrology of Large- and Small Animals, Justus-Liebig-University Giessen, Germany
    • Present address: Institute of Veterinary Anatomy, Vetsuisse-Faculty, University of Zurich, Winterthurerstr. 260, Zurich, Switzerland.
    • ,
  • B. Hoffmann

      Affiliations

    • Clinic for Obstetrics, Gynecology und Andrology of Large- and Small Animals, Justus-Liebig-University Giessen, Germany
    • ,
  • G. Ferreira-Dias

      Affiliations

    • Interdisciplinary Centre of Research in Animal Health, Faculty of Veterinary Medicine, TULisbon, Av. da Universidade Técnica, Alto da Ajuda, Polo Universitário, 1300-477 Lisboa, Portugal
    • ,
  • L. Lopes da Costa

      Affiliations

    • Interdisciplinary Centre of Research in Animal Health, Faculty of Veterinary Medicine, TULisbon, Av. da Universidade Técnica, Alto da Ajuda, Polo Universitário, 1300-477 Lisboa, Portugal
    • ,
  • L. Mateus

      Affiliations

    • Interdisciplinary Centre of Research in Animal Health, Faculty of Veterinary Medicine, TULisbon, Av. da Universidade Técnica, Alto da Ajuda, Polo Universitário, 1300-477 Lisboa, Portugal
    • Corresponding Author InformationCorresponding author at: Faculty of Veterinary Medicine, Reproduction and Obstetrics, Av. da Universidade Técnica, Alto da Ajuda, Polo Universitário, 1300-477 Lisboa, Portugal. Tel.: +351 213602050; fax: +351 213652827.

Received 10 July 2009; received in revised form 20 October 2009; accepted 25 October 2009. published online 18 November 2009.

Article Outline

Abstract 

Escherichia coli (E. coli) is the most frequent bacterium isolated in cases of cystic endometrial hyperplasia–pyometra complex, the most frequent endometrial disorder in the bitch. Toll-like receptors (TLRs) play an essential role in the innate immune system. The aim of this study was to compare transcription of genes encoding TLR2, TLR4 and LPS ligands (CD14, MD-2, LBP), prostaglandin synthesis enzymes (COX1, COX2, PGES1 and PGFS), and to compare COX1 and COX2 protein expression and PGE2 and PGF2α endometrial content in the endometrium of canine diestrous uteri with (n=7) or without (n=7) pyometra. All cases of pyometra were hyperplastic and E. coli was the only isolated bacteria, while diestrous normal uteri did not present signs of cystic endometrial hyperplasia and were negative for bacteriology. Except for COX1, transcription of all genes was significantly higher in pyometra than in normal endometria. COX1 protein was observed in both normal and pyometra uteri, but COX2 protein was only present in pyometra cases. Endometrial PGE2 and PGF2α content were significantly higher in pyometra than in normal diestrous endometria. In conclusion, data obtained in this study provides evidence that pyometra-isolated E. coli induces the up-regulation of TLR2 and TLR4 genes in the canine diestrous endometrium. This up-regulation, which is probably the result of the stimulation by LPS and lipoprotein E. coli constituents, leads to the endometrial up-regulation of PG synthesis genes. This, in turn, results in a higher endometrial concentration of PGE2 and PGF2α, which may further regulate the local inflammatory response.

Keywords: Pyometra, E. coli, TLR, Prostaglandins, Bitch

 

Back to Article Outline

1. Introduction 

In the bitch, cystic endometrial hyperplasia (CEH)–pyometra complex is the most frequent uterine disorder occurring during diestrus. In pyometra cases, a common isolate of uterine swabs is Escherischia coli (E. coli). Its presence is normally associated with highly severe systemic signs and a potentially life-threatening situation.

Pyometra E. coli isolates are similar to uropathogenic strains, sharing the same virulence factors (uropathogenic virulence factor genes) (Chen et al., 2003). Operons that encode for P-fimbriae (pap), for α-haemolysin (hlyA) and for cytotoxic necrotising factor 1 (cnf1) probably enhance the virulence of the strains in the canine genital tract (Hagman and Kühn, 2002, Chen et al., 2003).

Phylogenetic grouping analysis has been used to investigate the evolutionary origins of pathogenic E. coli strains. Four main phylogenetic groups were described: A, B1, B2 and D (Herzer et al., 1990, Clermont et al., 2000). Extraintestinal pathogenic E. coli strains belong mainly to group B2 and harbour several virulence factor genes (VF-genes). A small number of strains belong to group D (Picard et al., 1999, Johnson and Stell, 2000). In contrast, most commensal E. coli strains belong to group A and B1 and harbour few VF-genes compared to the corresponding pathogenic strains (Duriez et al., 2001).

Uterine response to infection includes innate and acquired immune defence mechanisms. The innate mechanisms rely on germ-line-encoded pattern recognition receptors (Toll-like receptors; TLRs) that recognize and interact with conserved pathogen-associated molecular patterns (PAMP) synthesized by microorganisms and, thereby, initiate a cascade of signalling events that include an early inflammatory response (Horne et al., 2008). In humans as in cattle, TLRs are present in both endometrial epithelial and stromal cells (Herath et al., 2006, Horne et al., 2008, Davies et al., 2008). Of the 13 described mammalian TLRs, TLR2 and TLR4 are the best characterized with respect to innate responses to bacteria. TLR4 is the signal transduction receptor for Gram-negative bacterial lipopolysaccharide (LPS) and heat shock proteins (Pioli et al., 2004). However, LPS alone is unable to interact with TLR4: circulating LPS reaches the receptor complex CD14/MD-2/TLR4 through the LPS binding protein (LBP) (Schumann et al., 1990, Kitchens, 1999, Gioannini et al., 2004); then, it initiates a downstream signalling cascade that culminates in the secretion of pro-inflammatory cytokines and chemokines (Horne et al., 2008). Toll-like receptor 2 agonists presently known are lipoteichoic acid (LTA) from Gram-positive bacteria and bacterial lipoproteins/lipopeptides from Gram-negative and Gram-positive bacteria (Zähringer et al., 2008).

One of the cellular downstream products of TLR signalling is cyclooxygenase-2 (COX2). After a pro-inflammatory stimulus such as LPS, interleukin-1β (IL-1β) and/or tumor necrosis factor alpha (TNFα), prostaglandin E2 synthase (PGES) gene expression is up-regulated, and coupled with COX2 gene expression, promoting delayed PGE2 synthesis (Helliwell et al., 2004, Park et al., 2006, Weems et al., 2004, Mosca et al., 2007). PGE2 plays important roles in various inflammatory responses (Rocca and FitzGerald, 2002). Recently, we have shown that COX2, PGES and PGFS gene transcription are up-regulated in the endometrium of the bitch with E. coli pyometra (Silva et al., 2009). However, the potential role of TLRs signalling in the inflammatory response to uterine E. coli infection was not reported.

The aim of this study was to evaluate the inflammatory response signalling pathway that occurs in pyometra and, specifically: (i) to compare transcription of genes encoding TLR2, TLR4 and LPS ligands in the endometrium of canine diestrous uteri with or without pyometra; (ii) to correlate the transcription patterns of genes encoding prostaglandin (PG) synthesis enzymes (COX1, COX2, PGES1 and PGFS) and COX1 and COX2 protein expression with the PGE2 and PGF2α endometrial content in normal diestrous and pyometra uteri.

Back to Article Outline

2. Materials and methods 

2.1. Animals 

Fourteen bitches presented to the hospital of the Faculty of Veterinary Medicine of Lisbon were selected for the study. All bitches were in the diestrous phase of the estrous cycle, with half of them (n=7) suffering from pyometra, with E. coli contributing to the underlying aetiology. This diagnosis was based on case history, clinical signs and the ultrasonographic finding of an enlarged, fluid-filled uterus and the isolation of E. coli from intra-uterine swabs. In all bitches, a blood sample for haematologic and biochemical analysis was collected prior to ovariohysterectomy (OVX). The average age of bitches with or without pyometra was 9.7 years (range 4–13 years) and 5.2 years (range 3–10 years), respectively.

2.2. Sample collection 

Immediately after OVX, endometria were collected from the middle part of both horns, rinsed with sterile RNAse-free cold saline solution, immediately frozen in liquid nitrogen and stored at −80°C until processing. For immunohistochemistry (IHC) and histological classification, cranial and caudal uterine tissue was individually fixed for 24h in 10% neutral phosphate buffered formalin. After washing in phosphate buffered saline (PBS) and subsequent dehydration in ethanol, samples were embedded in paraffin. Histological classification of CEH/pyometra was undertaken according to De Bosscherre et al. (2001). Upon opening of the uterus, an intra-uterine swab was processed for bacteriological analysis. The phase of the estrous cycle was determined based on the recorded estrus date, observation of ovarian structures and measurement of plasma progesterone concentrations. Progesterone was assayed in duplicate and quantified by a validated solid-phase radioimmunoassay, without extraction, using a commercial kit (Coat-A-Count, Diagnostic Product Corporation, Los Angeles, CA, USA) The intra-assay coefficient of variation for all samples was 3.2%.

2.3. Bacteriological characterization 

2.3.1. Bacteria isolation 

Uterine swabs were inoculated into Columbia 5% sheep blood agar (bioMerieux, Marcy L’Etoile, France) and MacConkey agar (Merck, Darmstadt, Germany), plates and were incubated at 37°C overnight. For the purpose of this study, only pyometra caused by E. coli were considered. Colonies with phenotypic characteristics of E. coli and lactose-fermenting on MacConkey agar were selected for identification with the API 20E system (bioMerieux). Upon identification, the isolates were kept frozen at −80°C.

2.3.2. Phylogenetic and virulence factor genes analysis 

Phylogenetic grouping of E. coli strains was performed using a triplex PCR targeting the genes chuA, yjaA and the DNA fragment TspE4-C2 as described by Clermont et al. (2000). E coli J96 and verotoxin-producing E. coli O157:H7 (ATCC 43895) were used as positive controls for phylogenetic groups B2 and D, respectively.

Strains were screened for uropathogenic virulence factor genes [(papEF (P-fimbriae), sfaDE (S-fimbriae), afaBC (afimbrial adhesion 1 or Afa1), hlyA (α-haemolysin), cnf1 (cytotoxic necrotizing factor 1, CNF1) and iucD (aerobactin)] using the primers described by Yamamoto et al. (1995) and for cnf2 (cytotoxic necrotizing factor 2, CNF2) as described by Kaipainen et al. (2002). Strains E. coli J96 (positive for hlyA, cnf1, sfa and pap), KS52 (positive for afa, iuc and pap) were used as positive controls in the PCR reactions.

2.4. Endometrial RNA extraction and cDNA synthesis 

Uterine samples (20–30mg) were pulverized with a sterile mortar and pestle. Total RNA was extracted using the Rneasy Mini kit (Qiagen GmbH, Hilden, Germany) and DNA digestion was performed with the RNase-free DNase Set (Promega, Wood Hollow road, Madison, USA). Concentration and purity of RNA were determined spectrophotometrically at 260 and 280nm and RNA quality was assessed by visualization of 28S and 18S rRNA bands after electrophoresis through a 1.5% gel agarose with ethidium bromide staining.

Complementary DNA (cDNA) synthesis was obtained by reverse transcription of 500ng of total RNA primed with 1μl of oligo(dT)15 primer (500ng/μl) (Promega) and 1μl of random hexamers (500ng/μl) (Promega). This mixture was heated at 70°C for 5min and cooled on ice for RNA denaturation. Subsequently, 1μl of dNTPs (10mM), 4μl 5× Transcriptase reaction buffer (Promega), 1μl RNasin (40U/μl) (Promega) and 1μl of M-MLV Reverse Transcriptase enzyme (200 u/μl) (Promega) were added. The reactions were carried out for 1h at 37°C, 15min at 42°C and for a further 5min at 94°C. The cDNAs were diluted to 1:5 with RNAse-free water prior to real-time PCR. cDNA samples were stored at −20°C until real-time PCR amplification.

2.5. Real-time PCR 

Quantification of COX1, COX2, PGES1 and PGFS transcripts were done as described by Silva et al. (2009). For TLR2, TLR4, CD14, MD2 and LBP, primers (Table 1) were first chosen with Primer3 Software and confirmed with Primer Express® Software (Applied Biosystems, Foster City, CA, USA). To avoid genomic DNA amplification, primers were designed to bracket two exons. Ribosomal protein L27 gene was chosen as the housekeeping gene. Real-time PCR was performed in duplicate wells on ABI Prism® 7300 SDS (Applied Biosystems, Foster City, CA, USA), using the universal temperature cycles: 10min of pre-incubation at 95°C, followed by 45 two-temperature cycles (15s at 95°C and 1min at 60°C). Melting curves were acquired (15s at 95°C, 30s at 60°C and 15s at 95°C) to ensure that a single product was amplified in the reaction. All PCR reactions were carried out in 96-well optical reaction plates (Applied Biosystems, Warrington, UK) with 12.5μl of Power SYBR® Green PCR Master Mix (Applied Biosystems, Warrington, UK), 0.5μl of diluted cDNA, 80 or 160nM of each primer in a total reaction volume of 25μl. After analysing the melting curves, the PCR products were run through a 2.5% agarose gel to confirm expected product size. The identity of PCR products was initially confirmed by DNA sequencing. The data of relative mRNA quantification was analysed with the real-time PCR Miner algorithm (Zhao and Fernald, 2005).

Table 1. Primer sequences for mRNA of target genes.
Target geneSequence (5′–3′)GeneBank accession number
COX1FW—CACTCGTGTTCTGCCCTCTGTNM_001003023
RV—GCGTCTGGCAACTGCTTCTT

COX2FW—GTATGAGCACAGGATTTGACCAGTANM_001003354
RV—AATTCCGGTGTTGAGCAGTTTT

PGES1FW—CAGAGCCCACCGGAATGANM_001122854
RV—GGAAGAAGACGAGGAAGTGCAT

PGFSFW—GGCCAAGAGCTTCAACGAGANM_001012344
RV—AGGCTGCTCAGAGTCTCCATG

CD14FW—GCCGGGCCTCAAGGTACTEU263365
RV—TCGTGCGCAGGAAAAAGC

LPBFW—CAGCCAGCTTGGTTTATCATGAXM_542993
RW—TTGGTGGTCAGACGAATGTTAGA

TLR2FW—CACTTCAATCCCCCGTTCAANM_001005264
RW—AATAATCCACTTGCCGGGAATA

TLR4FW—CCTCTTGTCATTGGATACACTAGCTTNM_001002950
RW—TGCTGTTGTCCTTGTTCCTTGA

MD2FW—GGGAATACGATTTTCTAAGGGACAAXM_848045
RW—CGGTAAAATTCAAACAAAAGAGCTT

RPL27FW—ACAATCACCTCATGCCCACANM_001003102
RV—CTTGACCTTGGCCTCTCGTC

2.6. Measurement of PGs in uterine tissue 

2.6.1. Extraction 

PGs were extracted from the endometria according to a previously described method (Cook et al., 2003) with minor modifications. Briefly, frozen endometrium was pulverized in liquid nitrogen and around 50mg of tissue was homogenized in 500μl of 100% ethanol in glass test tubes. Following homogenization, 4ml of 50mM citrate buffer (pH 3.5) was added to each sample. The samples were inverted several times, placed at room temperature for 20min and centrifuged at 4000×g for 25min at 4°C. The supernatant was withdrawn for sample purification. The tubes were then inverted on an absorbent surface to remove any residual supernatant. The remaining protein pellet was stored for determination of protein content using the Bradford test (Bio-Rad Protein assay, Bio-Rad laboratories GmbH, Munich, Germany).

2.7. Sample purification 

Samples were purified according to the protocol described in the PGE2 and PGF2α kits. Briefly, C-18 solid-phase extraction Sep-Pak cartridges (Amprep™ Mini-Columms, GE healthcare Europe GmbH) were activated with ethanol followed by milli-Q water and the sample was passed through the column. The column was then washed again with milli-Q water, 15% ethanol and hexane. Finally, the PGs were eluted with ethyl acetate and stored at −80°C until assay. The ethyl acetate was then evaporated under a gentle stream of nitrogen. Each sample was reconstituted in 500μl EIA buffer. Recovery rate was 91.6±2.3%.

2.8. Prostaglandin measurement 

PGE2 and PGF2α concentrations in the endometrium were determined using an enzyme immunoassay (EIA) kit for PGF2α (Assay designs, Inc., Ann Arbor, USA) and PGE2 (R&D Systems Europe, Ltd., Abingdon, United Kingdom). The intra-assay coefficients of variation were 3.5% and 2.3% for PGE2 and PGF2α, respectively. All values were normalized to protein and are expressed as pg/mg protein.

2.9. Immunohistochemical staining procedure for COX2 and COX1 

Immunostaining was performed on consecutive histological sections for the determination of COX2 expression in uterine tissue obtained from the cranial and caudal part of the uteri. Sections were cut from paraffin-embedded tissues and mounted on Superfrost slides (Menzel Glaeser, D-38116 Braunschweig, Germany). Tissues were deparaffinized, rehydrated and washed under running tap water (5min). Immunohistochemical detection of COX2 was performed by an immunoperoxidase method using the primary monoclonal mouse anti-rat COX2 antibody (1:100, clone 33, BD Pharmingen, Erembodegem, Belgium) and with the protocol described previously (Kowalewski et al., 2006). Controls were incubated with the isotype-matched irrelevant monoclonal antibody Mab IgG1 (Dianova, Hamburg, Germany) at an equal concentration.

For COX1 immunostaining, endogenous peroxidase was quenched by incubating the slides in 0.3% hydrogen peroxide in methanol for 30min followed by antigen retrieval with incubation of slides in 10nM citrate buffer pH=6 for 5min at room temperature followed by a 15min microwave irradiation in an oven run at 560W. The slides were then cooled for 20min at room temperature. They were then rinsed in IHC buffer/0.3% Triton X pH 7.2–7.4 (IHC buffer: 0.8mM Na2HPO4, 1.47mM KH2PO4, 2.68mM KCl, 137mM NaCl) for 5min, and incubated with the protein blocking solution (Novocastra, Leica Biosystems, New Castle Ltd., United Kingdom) for 5min at room temperature in order to block unspecific binding sites. Sections were then incubated 1h at room temperature with the primary polyclonal goat anti-mouse COX1 antibody (1:50, M-20, Santa Cruz Biotechnology, Inc., Heidelberg, Germany). After rinsing in IHC buffer, the secondary biotinylated polyclonal swine anti-goat IgG antibody (Multi-link DakoCytomation, Glostrup, Denmark) diluted 1:100 in IHC buffer was added and slides were incubated for 30min at room temperature. After washing for 10min in IHC buffer, the color-reaction was initiated with the substrate DAB (Zytochem Plus HRP-DAB kit, Zytomed Systems, Berein, Germany) according to the manufacturer's instructions. Finally the slides were washed under running tap water for 5min, slightly counterstained with haematoxylin and embedded in entellan (Merck, Darmstadt, Germany). For negative controls, the primary antibody was omitted during the immunostaining procedure or substituted by goat serum (Dako Denmark A/S, Glostrup, Denmark).

2.10. Statistical analysis 

Data were analysed through a statistical software package (Statistica 5.0, StatSoft Inc., Tulsa, OK, USA, 1995), using the Mann–Whitney U-test. Significance was determined at the 5% confidence level (p<0.05).

Back to Article Outline

3. Results 

3.1. Animals and E. coli Isolates 

Bitches with normal uteri were at the second half of diestrus and had a negative bacteriological culture. Bitches with pyometra were at the beginning of the second half of diestrus. Mean progesterone concentrations were 11.4±3.2ng/ml (36.2nmol/l) and 3.6±1.2ng/ml (11.5nmol/l) in pyometra and diestrous bitches, respectively. Progesterone concentrations between groups were not statistical different. All pyometra bitches had signs of anorexia, prostration, polydipsia and polyuria and had altered haematological parameters. All E. coli strains were assigned to phylogenetic group B2. E. coli strains carried the operons for hlyA (α-haemolysin; n=2), for cnf1 and cnf2 (cytotoxic necrotising factor 1 and 2; n=7) and for pap and sfa (encoding for P- and S-fimbriae, respectively; n=7).

3.2. Histology and immunohistochemistry analysis 

There were no effects of site of tissue recovery on histological or immunostaining analysis. Normal diestrous uteri had no histological signs of CEH. All cases of pyometra were hyperplastic: the endometrial epithelium was hyperplastic and in most cases pseudostratified, forming many tuft-like structures containing neutrophils (Fig. 1d). A moderate to severe infiltration of neutrophils was observed in the stroma of the endometrium. Uterine glands were hyperplastic and dilated in varying degrees, containing mucopurulent exudate with a large amount of neutrophils in the lumen. Glandular proliferation and dilatation were particularly pronounced in the basal layer and, in some cases, in the whole endometrium, giving an appearance of the so-called “swiss cheese endometrium” as described by Nomura and Funahashi (1999).

  • View full-size image.
  • Fig. 1. 

    Relative mRNA level (Arbitary Units, AU) of COX1 evaluated by real-time PCR (A) and expression of COX1 by immunohistochemistry in diestrous (B, 100×) and pyometra (C and D, 400×) endometria. Black arrow indicates stained inflammatory cells in pyometra cases. Data is given as mean±standard error of the mean (SEM).

COX1 immunostaining was observed in luminal and glandular epithelium of both normal diestrous and pyometra endometria (Fig. 1b and d). Also, in pyometra cases staining was observed in inflammatory cells localized in the stroma as well as inside of the glands (Fig. 1c). COX2 immunostaining was scattered and restricted to cells in the stroma and small capillares in normal endometria (Fig. 2c and d). However, in pyometra endometria, strong staining was observed in luminal epithelium, glandular epithelium (functional and basal layer) and stromal cells. Staining was also observed in inflammatory cells localized in the stroma as well as inside of the glands (Fig. 2b).

  • View full-size image.
  • Fig. 2. 

    Relative mRNA level (Arbitary Units, AU) of COX2 evaluated by real-time PCR (A) and expression of COX2 by immunohistochemistry in pyometra (B, 100×) and diestrous (C, 400× and D, 100×) endometria. Black arrow head indicates stained blood vessels and black arrow indicates stained inflammatory cells in the stroma. Data is given as mean±SEM. *p<0.001 (Mann–Whitney U-test).

3.3. Gene transcription 

Except for COX1 (Fig. 1a), gene transcription was significantly increased in pyometra compared with normal diestrous endometria. COX2 gene transcription was 19 times higher in pyometra than in diestrous endometria (p<0.01) (Fig. 2a), and PGFS and PGES gene transcription had a 2.9 and 11.3 fold increase in pyometra endometria compared to normal diestrous endometria, respectively (p<0.05 and p<0.01) (Fig. 3).

  • View full-size image.
  • Fig. 3. 

    Relative mRNA level (Arbitary units, AU) evaluated by real-time PCR in pyometra (n=7) and diestrous (n=7) endometria of bitches for the genes PGFS (A) and PGES (B). Data is given as mean±standard error of the mean (SEM). *p<0.05 and *p<0.01 for PGFS and PGES, respectively (Mann–Whitney U-test).

Gene transcription of TLR2 and TLR4 were, respectively, 6.0 and 2.4 times higher in pyometra cases compared to normal uteri (p<0.01) (Fig. 4). Also, CD14, MD2 and LBP gene transcription showed an 8.3, 3.5 and 4.6 fold increase in pyometra cases compared to normal diestrous endometria, respectively (p<0.01; 0.01 and 0.05, respectively) (Fig. 5).

  • View full-size image.
  • Fig. 4. 

    Relative mRNA level (Arbitary Units, AU) evaluated by real-time PCR in pyometra (n=7) and diestrous (n=7) endometria of bitches for the genes TLR2 (A) and TLR4 (B). Data is given as mean±SEM. *p<0.01 (Mann–Whitney U-test).

  • View full-size image.
  • Fig. 5. 

    Relative mRNA level (Arbitary Units, UA) evaluated by real-time PCR in pyometra (n=7) and diestrous (n=7) endometria of bitches for the genes CD14 (A), MD2 (B) and LBP (C). Data is given as mean±SEM. *p<0.01 (for the genes cd14 and md2) and *p<0.05 (for the gene lbp) (Mann–Whitney U-test).

3.4. Endometrial prostaglandin content 

Endometrial PGE2 content was higher in pyometra than in normal diestrous endometria tissue (2746±712pg/mg protein and 775±71pg/mg protein, p<0.01, respectively) (Fig. 6a). Similarly, PGF2α content was higher in pyometra than in diestrous endometrial tissue (18770±2782pg/mg protein and 2998±739pg/mg protein, p<0.01, respectively) (Fig. 6b).

  • View full-size image.
  • Fig. 6. 

    Concentration (pg/mg of protein) of PGE2 (A) and PGF2α (B) in pyometra (n=7) and diestrous (n=7) endometria of bitches. Data is given as mean±SEM. *p<0.01 (Mann–Whitney U-test).

Back to Article Outline

4. Discussion 

This paper reports for the first time the involvement of the TLRs signalling cascade on the inflammatory uterine response to E. coli infection in the bitch and also provides an insight into the role of PGs in this response. Although TLR2 and TLR4 were transcribed in the normal canine diestrous endometrium, these genes were significantly up-regulated in E. coli pyometra cases, possibly due to the action of bacterial wall LPS and lipoprotein (Zähringer et al., 2008), on the endometrial cells. The up-regulation of these genes in pyometra cases probably also reflect the high infiltration of leukocytes, mainly neutrophils, in the endometrium in response to pathogen challenge. Hayashi et al. (2003) have shown that, in humans, peripheral blood neutrophils express all TLRs excepted TLR 13, and that TLR activation in these cells are associated with phagocytosis, production of cytokines and chemokines (especially IL-8), selectin-shedding, and generation of superoxide.

Endotoxins (LPS) strongly stimulate prostaglandin synthesis, especially of PGE2 (Helliwell et al., 2004). Recently, we have shown that in pyometra uteri the transcription of the genes involved in PGE2 and PGF2α synthesis (COX2, PGES and PGFS) are up-regulated (Silva et al., 2009). In the present study, we confirmed the same results and showed that COX2 expression is up-regulated at the glandular and luminal epithelium as well as in the inflammatory cells. Although not significant, the small increase of COX1 gene transcription observed in pyometra cases might be associated with the positive staining of the inflammatory cells which are in high number localized in the stroma and inside of the glands. The higher PGE2 content measured in pyometra endometria most likely results from the synchronized up-regulation of COX2 and PGES after endotoxin stimulation, as demonstrated by others (Helliwell et al., 2004). PGE2 is known for its immunosuppressive effect and the immunomodulatory role of PGE2 is observed on lymphocytes, monocytes/macrophages and PMN (Rocca and FitzGerald, 2002). The high uterine concentrations of PGE2 could further contribute to the suppressed activity of cellular immunity during diestrus.

The endometria of bitches with pyometra had significantly higher PGFS gene transcription levels and PGF2α content than healthy diestrous endometria, which can justify the higher systemic concentrations of PGFM observed in bitches with pyometra (Hagman et al., 2005, Hagman et al., 2006).

All pyometra bitches had signs of anorexia, prostration, polydipsia and polyuria and had altered haematological parameters. Endotoxin is thought to be responsible for the systemic signs of pyometra in bitches, with higher plasma concentrations being associated with poor prognosis (Okano et al., 1998). It has been demonstrated that CD14 and TLR4 are important in the mediation of LPS-induced anorexia (von Meyenburg et al., 2004). Activation of TLR2 and TLR4 by PAMP agonists results in the activation of NF-κB and JNK and p38 MAP-kinase, leading to the expression of pro-inflammatory cytokines such as tumor necrosis factor-α (TNFα), interleukin-1 (IL-1), interleukin-6 (IL-6), which orchestrate nonspecific and specific immune reactions (Medzhitov, 2001, Uematsu and Akira, 2006). In the most severe cases, pyometra has been associated with the systemic inflammatory response syndrome (SIRS), that can result from the uncontrolled production of the inflammatory mediators listed above and may provoke irreversible damage to internal organs or septic shock, which in some cases may lead to death (Purvis and Kirby, 1994).

As confirmed by plasma progesterone concentrations, all bitches were in diestrus. Pyometra is usually diagnosed during diestrus, although diagnosis can be done in anestrous bitches as well (Blendinger and Bostedt, 1991, Noakes et al., 2001). Recent research showed that the uterus was most susceptible to inoculated E. coli between days 11–30 after the LH peak (Tsumagari et al., 2005). This apparent suppressed cellular immunity observed in the first half of diestrus probably results from the increasing progesterone concentrations and minimal estrogen release (Sugiura et al., 2004). Also, progesterone causes an increased binding of E. coli to the endometrium (Leitner et al., 2003, Ishiguro et al., 2007). The histological appearance of uteri with E. coli pyometra was similar to that described by Nomura and Funahashi (1999) in induced E. coli pyometra during diestrus. These authors suggested that canine pyometra is a kind of naturally occurring decidual reaction (deciduoma) triggered by a bacterial stimulus.

All E. coli isolates harboured several uropathogenic virulence factor genes and belonged to the pathogenic B2 phylogenetic group. These genes probably enhance the virulence and pathogenicity of the strain in the canine genital tract by facilitating colonization of the endometrium (P- and S-fimbriae), enhancing tissue damage (α-haemolysin and CNF1 and CNF2) and/or increasing the amount of free iron available for bacterial growth (α-haemolysin) (Chen et al., 2003, Arora, 2007).

In conclusion, data obtained in this study provide evidence that pyometra-isolated E. coli induces the up-regulation of TLR2 and TLR4 genes in the canine diestrous endometrium. This up-regulation, which is probably the result of the stimulation by LPS and lipoprotein E. coli constituents, leads to the endometrial up-regulation of PG synthesis genes. This, in turn, results in a higher endometrial concentration of PGE2 and PGF2α, which may further regulate the local inflammatory response.

Back to Article Outline

Conflict of interest 

We do declare that there is no conflict of interest, which could be perceived as prejudicing the impartiality of the research reported.

Back to Article Outline

Acknowledgements 

The authors thank to the colleagues from the surgery at the FMV; to Professor Cristina Vilela and the technician Carla Carneiro for the bacteriological analyses and to Professor Contânça Pomba for providing the primers for the virulence factor genes. We also acknowledge the laboratory of Bioquimistry for helping with the Pg extraction procedures and to the histology technician Maria do Rosário Luís for technical assistance.

Funding: This work was supported by grants CIISA/FMV 74-Endometrial Hiperplasia and PTDC/CVT/66587/2006 from Foundation for Science and Technology (FCT). Maria Elisabete Silva was supported by a postdoctoral fellowship (BPD/35031/2007) from FCT.

Back to Article Outline

References 

  1. Arora N., 2007. Role of uropathogenic virulence factors in the pathogenesis of E. coli-induced cystic endometrial hyperplasia/pyometra complex in the bitch. Ph.D. Thesis, University of Melbourne, Australia.
  2. Blendinger K, Bostedt H. Zum Alter und Zyklusstadium bei Hündinnen mit Pyometra. Statistische Erhebungen und Erklärungsversuche zum Verständnis der Varaianilität. Tierärztliche Praxis. 1991;19:307–310
  3. Chen YMM, Wright PJ, Lee CS, Browning GF. Uropathogenic virulence factors in isolates of Echerichia coli from clinical cases of canine pyometra and feces of canine pyometra and feces of healthy bitches. Vet. Microbiol. 2003;94:57–69
  4. Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 2000;66:4555–4558
  5. Cook J, Shallow MC, Zaragoza DB, Anderson KI, Olson DM. Mouse placental prostaglandins are associated with uterine and the timing of birth. Biol. Reprod. 2003;68:579–587
  6. Davies D, Meade KG, Herath S, Eckersall PD, Gonzalez D, White J, et al. Toll-like receptor and antimicrobial peptide expression in the bovine endometrium. Reprod. Biol. Endocrinol. 2008;6:53
  7. De Bosscherre H, Ducatelle R, Vermeirsch H, Van Den Broeck W, Coryn M. Cystic endometrial hyperplasia–pyometra complex in the bitch: should the two entities be disconnected?. Theriogenology. 2001;55:1509–1519
  8. Duriez P, Clermont O, Bonacorsi S, Bingen E, Chaventré A, Elion J, et al. Commensal Escherichia coli isolates are phylogenetically distributed among geographically distinct human populations. Microbiology. 2001;147:1671–1676
  9. Gioannini TL, Teghanemt A, Zhang D, Coussens NP, Dockstader W, Ramaswamy S, et al. Isolation of an endotoxin–MD2 complex that produces Toll-like receptor 4-dependent cell activation at picomolar concentrations. Proc. Natl. Acad. Sci. U.S.A. 2004;101:4186–4191
  10. Hagman R, Kühn I. Escherichia coli strains isolated from the uterus and urinary bladder of bitches suffering from pyometra: comparison by restriction enzyme digestion and pulsed-field gel electrophoresis. Vet. Microbiol. 2002;84:143–153
  11. Hagman R, Kindahl H, Fransson B, Bergström A, Holst B, Lagerstedt A. Differentiation between pyometra and cystic endometrial hyperplasia/mucometra in bitches by prostaglandin F2α metabolite analysis. Theriogenology. 2005;66:198–206
  12. Hagman R, Kindahl H, Lagerstedt A. Pyometra in bitches induces elevated plasma endotoxin and prostaglandin F2α metabolite levels. Acta Vet. Scand. 2006;47:55–68
  13. Hayashi F, Means TK, Luster AD. Toll-like receptors stimulate human neutrophil function. Blood. 2003;102:2660–2669
  14. Helliwell R, Adams L, Mitchell M. Prostaglandin synthases: recent developments and a novel hypothesis. Prostaglandins Leukot. Essent. Fatty Acids. 2004;70:101–113
  15. Herath S, Fisher DP, Werling D, Williams EJ, lilly ST, Dobson H, et al. Expression and function of Toll-like receptor 4 in the endometrial cells of the uterus. Endocrinology. 2006;147:562–570
  16. Herzer PJ, Inouye S, Inouye M, Whittam TS. Phylogenetic distribution of branched RNA-linked multicopy single-stranded DNA among natural isolates of Escherichia coli. J. Bacteriol. 1990;172:6175–6181
  17. Horne A, Stock S, King A. Innate immunity and disorders of the female reproductive tract. Reproduction. 2008;135:739–749
  18. Ishiguro K, Baba E, Torii R, Tamada H, Kawate N, Hatoya S, et al. Reduction of mucin-1 gene expression associated with increased Escherichia coli adherence in the canine uterus in the early stage of dioestrus. Vet. J. 2007;173:325–332
  19. Johnson JR, Stell AL. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host comprise. J. Infect. Dis. 2000;181:261–272
  20. Kaipainen T, Pohjanvirta T, Shpigel NY, Shwimmer A, Pyörälä S, Pelkonen S. Virulence factors of Escherichia coli isolated from bovine clinical mastitis. Vet. Microbiol. 2002;85:37–46
  21. Kitchens RL. Role of CD14 in cellular recognition of bacterial lipopolysaccharides. Chem. Immunol. 1999;74:61–82
  22. Kowalewski MP, Schuler G, Taubert A, Engel E, Hoffmann B. Expression of cyclooxygenase 1 and 2 in the canine corpus luteum during diestrus. Theriogenology. 2006;66:1423–1430
  23. Leitner M, Aurach JE, Galabova G, Aurachet C, Walter I. Lectin binding patterns in normal canine endometrium and in bitches with pyometra and cystic endometrial hyperplasia. Histol. Histopathol. 2003;18:787–795
  24. Medzhitov R. Toll-like receptor and innate-immunity. Nat. Rev. Immunol. 2001;1:135–145
  25. Mosca M, Polentarutti N, Mangano G, Apicella C, Doni A, Mancini F, et al. Regulation of the microsomal prostaglandin E synthase-1 in polarized mononuclear phagocytes and its constitutive expression in neutrophils. J. Leukoc. Biol. 2007;82:320–326
  26. Noakes DE, Dhaliwal GK, England G. Cystic endometrial hyperplasia/pyometra in dogs: a review of the causes and pathogenesis. J. Reprod. Fertil. Suppl. 2001;57:395–406
  27. Nomura K, Funahashi H. histological characteristics of canine deciduoma induced by intrauterine inoculation of E. coli suspension. J. Vet. Med. Sci. 1999;61:433–438
  28. Okano S, Tagawa M, Takase K. Relationship of the blood endotoxin concentration and prognosis in dogs with pyometra. J. Vet. Med. Sci. 1998;60:1265–1267
  29. Park JY, Pillinger MH, Abramson SB. Prostaglandin E2 synthesis and secretion: the role of PGE2 synthases. Clin. Immunol. 2006;119:229–240
  30. Picard B, Garcia JS, Gouriou S, Duriez P, Brahimi N, Bingen E, et al. The link between phylogeny and virulence in Escherichia coli extraintestinal infection. Infect. Immun. 1999;67:546–553
  31. Pioli PA, Amiel E, Schaefer TM, Connolly JE, Wira CR, Guyre PM. Differential expression of toll-like receptors 2 and 4 in tissues of the human female reproductive tract. Infection and Immunity. 2004;72:5799–5806
  32. Purvis D, Kirby R. Systemic inflammatory response syndrome: septic shock. Vet. Clin. North Am. Small Anim. Pract. 1994;24:1225–1247
  33. Rocca B, FitzGerald G. Cyclooxygenases and prostaglandinds: shaping up the immune response. Int. Immunopharmacol. 2002;2:603–630
  34. Schumann RR, Leong SR, Flaggs GW, Gray PW, Wright SD, Mathison JC, et al. Structure and function of lipopolysaccharide binding protein. Science. 1990;149:1429–1431
  35. Silva E, Leitão S, Ferreira-Dias G, Lopes da , Costa L, Mateus L. Prostaglandin synthesis genes are differentially transcripted in normal and pyometra endometria of bitches. Reprod. Domest. Anim. 2009;44(Suppl. 2):200–203
  36. Sugiura K, Nishikawa M, Ishiguro K, Tajima T, Inaba M, Torii R, et al. Effect of ovarian hormones on periodical changes in immune resistance associated with estrous cycle in the beagle bitch. Immunobiology. 2004;209:619–627
  37. Uematsu S, Akira S. Toll-like receptor and innate immunity. J. Mol. Med. 2006;84:712–725
  38. Tsumagari S, Ishinazaka T, Kamata H, Ohba S, Tanaka S, Ishii M, et al. Induction of canine pyometra by inoculation of Escherichia coli into the uterus and its relationship to reproductive features. Anim. Reprod. Sci. 2005;87:301–308
  39. von Meyenburg B, Hrupka H, Arsenijevic D, Schwartz GJ, Landmann R, Langhans W. Role for CD14, TLR2, and TLR4 in bacterial product-induced anorexia. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2004;287:R298–R305
  40. Weems YS, Weems CW, Carstens GE, Welsh TH, Randel RD. Do calcium-mediated cellular signalling pathways, prostaglandin E2, estrogen or progesterone receptor antagonists, or bacterial endotoxins affect bovine placental function in vivo?. Prostaglandin Other Lipid Mediat. 2004;73:265–278
  41. Yamamoto S, Terai A, Yuri K, Kurazono H, Takeda Y, Yoshida O. Detection of urovirulence factors in Escherichia coli by multiplex polymerase chain reaction. FEMS Immunol. Med. Microbiol. 1995;12:85–90
  42. Zähringer U, Lindner B, Inamura S, Heine H, Alexander C. TLR2—promiscuous or specific? A critical re-evaluation of a receptor expressing apparent broad specificity. Immunobiology. 2008;213:205–224
  43. Zhao S, Fernald RD. Comprehensive algorithm for quantitative real-time polymerase chain reaction. J. Comput. Biol. 2005;12:1047–1064

PII: S0165-0378(09)00497-5

doi:10.1016/j.jri.2009.10.004

Journal of Reproductive Immunology
Volume 84, Issue 1 , Pages 66-74, January 2010

Article Tools

* Image Usage & Resolution